?(Fig.3b),3b), indicating that these cells represent a more hostile environment than that presented by murine cells. Open in a separate window FIG. in morbidity, rather than sterile immunity, is the target. Thus, a partially protective vaccine would be effective. The bacillus Calmette-Gurin (BCG), a live attenuated strain that has been used for the prevention of human tuberculosis for decades, is considered AM679 a promising candidate for the development of live vector systems for the delivery of foreign antigens to the immune system (16, 25). Several advantages are associated with the use of BCG as an antigen-presenting system, including its known adjuvant properties, its ability to elicit humoral or cellular immune responses toward heterologous antigens, its thermostability, which eliminates the need for a cold chain, and most importantly, the possibility of obtaining an efficient immune response by using a single dose. During the last AM679 10 years, expression systems have been developed for the production of a variety of bacterial, parasitic, and viral antigens by BCG, and the capacity of these recombinant systems to induce both cellular and humoral immune responses in various experimental models is usually well documented (2, 17, 20, 25). Furthermore, it has been exhibited that recombinant BCG strains can induce protective immunity in animal models (1, 24, 29). Recombinant BCG technology has previously been employed in the development of experimental schistosomiasis vaccines based on the AM679 enzyme glutathione (19) and (18). Both vaccines were found to elicit significant humoral immune responses toward the recombinant antigen when they were administered by a variety of routes, although no information is usually available about the potential protective capacities of these constructs. For the present study, we developed a recombinant BCG strain which expresses the Sm14 antigen on the surface of the bacterium. Thereafter, the stability AM679 of the construct was evaluated in murine and bovine monocyte cultures. Immunization of mice with this strain induced an Sm14-specific Th1-based immune response, which paralleled a significant reduction in the worm burden in outbred Swiss mice challenged with cercaria. MATERIALS AND METHODS Bacterial strains, growth conditions, and vaccine preparation. All cloning actions were performed with DH5 grown in Luria-Bertani medium supplemented with ampicillin (100 g/ml) or kanamycin (20 g/ml). The BCG Pasteur strain 1172P2 was used to generate recombinant BCG (rBCG) strains. Liquid cultures of BCG AM679 strains were routinely produced in Middlebrook 7H9 medium supplemented with an albumin-dextrose-catalase enrichment (MB7H9; Difco, Detroit, Mich.), with or without kanamycin (20 g/ml), in stationary 25-cm2 tissue culture flasks at 37C in a humidified 5% CO2 atmosphere. The rBCG strains were cultured in Ungar’s medium for heterologous protein localization assays. BCG was transformed by electroporation as previously described (25a) and plated onto Middlebrook 7H10 agar plates supplemented with an oleic acid-albumin-dextrose-catalase enrichment (MB7H10; Difco) made up of kanamycin (20 Rabbit Polyclonal to CDC25C (phospho-Ser198) g/ml). Plates were incubated at 37C for 3 weeks before expansion of the transformed colonies in liquid medium. rBCG vaccines were prepared from mid-log-phase liquid cultures of selected clones. The liquid cultures were centrifuged at 4,000 gene (31), pGEM-T Easy (Promega), and the mycobacterial expression vectors pLA71, pLA73 (22), and pMIP12 (21) were used. The mycobacterial expression vectors contain the and mycobacterial origins of replication, a kanamycin resistance gene, the up-regulated promoter pBlaF*, its ATG initiation codon, and a multicloning site which places the heterologous gene in fusion with the signal sequence or the whole -lactamase-encoding gene in pLA71 and pLA73, respectively. pMIP12 has a conserved mycobacterial Shine-Dalgarno sequence that may elevate antigen expression, and the native gene is expressed. Construction of expression vector. The 402-bp fragment made up of the gene was amplified by PCR from pGEMEX-sm14, using the following primers: 5TAGGGTACCCTGTAGTTTCTTGGGAAAGTGGAA3 (a KpnI site is usually underlined) and 5TAGGGTACCand mycobacterial origins of replication, a kanamycin resistance gene (sequence, while pPL12-sm14 has a conserved mycobacterial Shine-Dalgarno sequence (Mega SD). Western blotting and localization of heterologous proteins in rBCG. A Western blot analysis of individual kanamycin-resistant BCG transformants was performed by using a previously reported protocol (20), with.